ROUGE

Gene/Protein Characteristic Table for mKIAA1272

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173140
Description :
Clone Name :	mic25008 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 4316 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2911 bp

Genome contig ID gi66880554r_145599098
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTCTTGTTGATTAGACTTTCATGCTGTAAAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAATAAAAATAAAAAAGTAACCCCACAAAACTTGGATGTTTTAAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1272 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1272	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1405
Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH96528	1.8e-207	99.8	A230067G21Rik p...	Mus musculus
EDL28504	2.2e-207	99.8	mCG142118, isof...	Mus musculus
A3KGS3	3.9e-207	99.8	250 kDa substra...	Mus musculus
CAM46125	4e-207	99.8	novel protein (...	Mus musculus
CAX15312	1.2e-206	99.8	novel protein (...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172955	7.7e-12	27.4	mKIAA0474
AK122284	6.8e-09	28.2	mKIAA0440
AK122501	6.9e-09	27.3	mKIAA1389
AK220472	7.1e-08	24.6	mKIAA4074

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000331 258 437 PF02145 Rap/ran-GAP

ProfileScan IPR000331 258 415 PS50085 Rap/ran-GAP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	258	437	PF02145	Rap/ran-GAP
ProfileScan	IPR000331	258	415	PS50085	Rap/ran-GAP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2911 bp
Genome contig ID	gi66880554r_145599098
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTCTTGTTGATTAGACTTTCATGCTGTAAAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAATAAAAATAAAAAAGTAACCCCACAAAACTTGGATGTTTTAAAA

Gene/Protein Characteristic Table for mKIAA1272

Features of the cloned DNA sequence

Features of the protein sequence