ROUGE |
Gene/Protein Characteristic Table for mKIAA1271 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC037391 |
---|---|
msj04376 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2587 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1233 bp Genome contig ID gi66880554f_130654210 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
GTTTTATCAGGATAATTAAAAGAGTTTATCTGTGCFlanking genome sequence
(107668 - 107717) ----+----*----+----*----+----*----+----*----+----*
AAATCTTGTGAGTTCCAAATTTCTTAAAGGATGGATACATGTTATCACCA
KIAA Alignment based on: KIAA1271 DNA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1351
Length: 450 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |