ROUGE

Gene/Protein Characteristic Table for mKIAA1271

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC037391
Description :
Clone Name :	msj04376 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2587 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1233 bp

Genome contig ID gi66880554f_130654210
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GTTTTATCAGGATAATTAAAAGAGTTTATCTGTGC
Flanking genome sequence
(107668 - 107717)
----+----*----+----*----+----*----+----*----+----*
AAATCTTGTGAGTTCCAAATTTCTTAAAGGATGGATACATGTTATCACCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1271 DNA sequence, Physical map

KIAA	Alignment based on:
KIAA1271	DNA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1351
Length: 450 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8VCF0	6e-144	100.0	Mitochondrial a...	Mus musculus
EDL28316	6e-144	100.0	RIKEN cDNA D430...	Mus musculus
Q66HG9	8.8e-109	79.1	Mitochondrial a...	Rattus norvegicus
BAE32168	5.3e-102	100.0	unnamed protein...	Mus musculus
BAF42542	1.9e-32	47.1	mitochondrial a...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 423 444 WAKWLGATSALLAVFLAVMLYR

Method	From	To	amino acid sequence
SOSUI	423	444	WAKWLGATSALLAVFLAVMLYR

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1233 bp
Genome contig ID	gi66880554f_130654210
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GTTTTATCAGGATAATTAAAAGAGTTTATCTGTGC
Flanking genome sequence (107668 - 107717)	----+--------+--------+--------+--------+----* AAATCTTGTGAGTTCCAAATTTCTTAAAGGATGGATACATGTTATCACCA

Gene/Protein Characteristic Table for mKIAA1271

Features of the cloned DNA sequence

Features of the protein sequence