Gene/Protein Characteristic Table for mKIAA1266

Length: 1658 bp

Restriction map

Length of 3'UTR	89 bp
Genome contig ID	gi65550231f_81439667
PolyA signal sequence (AATAAA,-23)	+----*----+----*----+----*----+---- TTGTTTGTTTGCAATAAACATAAGTTCTTGTGTAC
Flanking genome sequence (186861 - 186910)	----+----*----+----*----+----*----+----*----+----* AGCCTTTGTTTTTTTTTTTTTTTAAACATTGTTCTTGTCTGCTGCCATTT

KIAA	Alignment based on:
KIAA1266	DNA sequence, AA sequence, Physical map

Coding region: 1..1569

Length: 522 aa

Entry Exp ID% Protein Source EDL38556 0 100.0 metastasis asso... Mus musculus EDL38557 0 99.8 metastasis asso... Mus musculus AAH22124 0 99.8 Mta3 protein [M... Mus musculus BAE26772 0 99.6 unnamed protein... Mus musculus AAH99960 0 99.2 Mta3 protein [M... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AB093210 4.7e-05 32.6 mKIAA0071 BC057141 0.00031 26.9 mKIAA1343 AK129405 0.00034 22.2 mKIAA1610

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	12	155	PF01426	Bromo adjacent region
	IPR000949	156	217	PF01448	ELM2
	IPR001005	276	322	PF00249	Myb
	IPR000679	387	424	PF00320	Zinc finger
HMMSmart	IPR001025	12	155	SM00439	Bromo adjacent region
	NULL	275	324	SM00395	NULL
	IPR000679	383	425	SM00401	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-