ROUGE

Gene/Protein Characteristic Table for mKIAA1252

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173137
Description :	Sphingosine-1-phosphate lyase 1.
Clone Name :	mtj01938 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 4051 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2225 bp

Genome contig ID gi65524842r_60960663
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TCAAAAGCAATTGAATAATAAATGTCCCAAACTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCATTGGATGGTTGATTTTTAGATAGATAGATAGATAGATAGATAGAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1252 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1252	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 69..1826
Length: 585 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8R0X7	100.0	Sphingosine-1-p...	Mus musculus
CAJ18422	99.8	Sgpl1 [Mus musc...	Mus musculus
AAC03768	99.8	sphingosine-1-p...	Mus musculus
BAE29269	99.8	unnamed protein...	Mus musculus
BAC31437	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002129 155 473 PF00282 Pyridoxal-dependent decarboxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002129	155	473	PF00282	Pyridoxal-dependent decarboxylase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 60 82 IAWSVLCTLLIVWVYELIFQPES

Method	From	To	amino acid sequence
SOSUI	60	82	IAWSVLCTLLIVWVYELIFQPES

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2225 bp
Genome contig ID	gi65524842r_60960663
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCAAAAGCAATTGAATAATAAATGTCCCAAACTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCATTGGATGGTTGATTTTTAGATAGATAGATAGATAGATAGATAGAT

Gene/Protein Characteristic Table for mKIAA1252

Features of the cloned DNA sequence

Features of the protein sequence