KIAA1252

Product ID	ORK00781
Accession No	AB033078
Description	sphingosine-1-phosphate lyase 1
Clone name	hh09572
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5741 bp) Predicted protein sequence (580 aa)
HaloTag ORF Clone	FHC00781
Flexi ORF Clone	FXC00781
Source	Human adult brain
Rouge ID	mKIAA1252 by Kazusa Mouse cDNA Project

Length: 5741 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3834 bp
Genome contig ID	gi89161187f_72145732
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGGATTAATTTTAGAATAAACCTATTTATTTCT
Flanking genome sequence (165206 - 165255)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAAGAAAGTGTTACCTGTGTCTTTGTCTCACATGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	72245732	72310936	15	99.3	Perfect prediction

Length: 580 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O95470	100.0	Sphingosine-1-p...	Homo sapiens
XP_521504	99.8	sphingosine-1-p...	Pan troglodytes
CAA09590	99.8	sphingosine-1-p...	Homo sapiens
XP_001171350	99.6	sphingosine-1-p...	Pan troglodytes
Q5R4G0	99.5	Sphingosine-1-p...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002129	155	468	PF00282	Pyridoxal phosphate-dependent decarboxylase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	51	PWQLIAWSVVWTLLIVWGYEFVF	73	PRIMARY	23

Primer_f	TCTGCATCACATTACTACACG
Primer_r	TTCTGCAACCATATTCCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-