Order Kazusa clone(s) from : ![]() |
Product ID | ORK04720 |
---|---|
Accession No | AB033075 |
Description | ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 |
Clone name | hh04184 |
Vector information | |
cDNA sequence | DNA sequence (5475 bp) Predicted protein sequence (949 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1249
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2624 bp |
---|---|
Genome contig ID | gi51511724r_131033535 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 131133535 | 131262290 | 23 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 892 | 944 | PD000066 | Src homology-3 |
FPrintScan | IPR001164 | 271 | 290 | PR00405 | Arf GTPase activating protein |
IPR001164 | 290 | 307 | PR00405 | Arf GTPase activating protein | |
IPR001164 | 311 | 332 | PR00405 | Arf GTPase activating protein | |
IPR000108 | 791 | 808 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 890 | 900 | PR00452 | Src homology-3 | |
IPR000108 | 892 | 912 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 904 | 919 | PR00452 | Src homology-3 | |
IPR000108 | 912 | 928 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 921 | 930 | PR00452 | Src homology-3 | |
IPR001452 | 935 | 947 | PR00452 | Src homology-3 | |
HMMPfam | IPR001849 | 145 | 236 | PF00169 | Pleckstrin-like |
IPR001164 | 259 | 382 | PF01412 | Arf GTPase activating protein | |
IPR002110 | 420 | 455 | PF00023 | Ankyrin | |
IPR002110 | 456 | 488 | PF00023 | Ankyrin | |
IPR001452 | 890 | 947 | PF00018 | Src homology-3 | |
HMMSmart | IPR001849 | 145 | 238 | SM00233 | Pleckstrin-like |
IPR001164 | 259 | 382 | SM00105 | Arf GTPase activating protein | |
IPR002110 | 420 | 452 | SM00248 | Ankyrin | |
IPR002110 | 456 | 485 | SM00248 | Ankyrin | |
IPR001452 | 890 | 948 | SM00326 | Src homology-3 | |
ProfileScan | IPR001849 | 144 | 236 | PS50003 | Pleckstrin-like |
IPR001164 | 259 | 372 | PS50115 | Arf GTPase activating protein | |
IPR002110 | 420 | 455 | PS50088 | Ankyrin | |
IPR002110 | 420 | 497 | PS50297 | Ankyrin | |
IPR001452 | 887 | 949 | PS50002 | Src homology-3 |
![]() |
Primer_f | CGAGTGAAGACCATTTATGAC |
---|---|
Primer_r | TTGCTAGTCAGACAGGATATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCAAACAGAGCATGAGGAACC |
Primer_r | GTGTAAATGAATGACCGGGAC |
PCR product length | 138 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |