ROUGE

Gene/Protein Characteristic Table for mKIAA1238

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173135
Description :
Clone Name :	mfj02086 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4024 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2585 bp

Genome contig ID gi65504368r_123018090
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTATGAACTATGCCACTTAAACTTTCTAATTGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TAAGCTTTTTTGATACTTTGTTCATTTCTGCTGGCTTTTCTCCAATGAAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1238 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1238	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 72..1439
Length: 455 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80WS1	3.8e-144	100.0	Ribosomal prote...	Mus musculus
XP_342750	3.5e-142	98.2	hypothetical pr...	Rattus norvegicus
XP_001118430	5.2e-142	95.0	hypothetical pr...	Macaca mulatta
XP_543825	7.6e-142	95.7	hypothetical pr...	Canis lupus fam...
XP_001927870	2.1e-140	97.2	hypothetical pr...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMTigr IPR004666 76 371 TIGR00768 S6 modification enzyme RimK

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMTigr	IPR004666	76	371	TIGR00768	S6 modification enzyme RimK

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2585 bp
Genome contig ID	gi65504368r_123018090
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTATGAACTATGCCACTTAAACTTTCTAATTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TAAGCTTTTTTGATACTTTGTTCATTTCTGCTGGCTTTTCTCCAATGAAC

Gene/Protein Characteristic Table for mKIAA1238

Features of the cloned DNA sequence

Features of the protein sequence