Gene/Protein Characteristic Table for mKIAA1237

Length: 1971 bp

Restriction map

Length of 3'UTR	18 bp
Genome contig ID	gi65546577f_32434917
PolyA signal sequence (None)	+----*----+----*----+----*----+---- GGAGAGACTACTTCTGAGTCCAGGAGACAGAGGGA
Flanking genome sequence (139996 - 140045)	----+----*----+----*----+----*----+----*----+----* GGCCCCCGTTTCTCTGAGCCACTTCCCCGGACATCTGGCTCAGAGCACTA

KIAA	Alignment based on:
KIAA1237	DNA sequence, AA sequence, Physical map

Coding region: 1..1953

Length: 650 aa

Entry Exp ID% Protein Source AAH76596 0 100.0 HEG homolog 1 (... Mus musculus NP_780465 0 100.0 HEG homolog 1 [... Mus musculus EDK97849 0 99.8 mCG127133, isof... Mus musculus EDM11356 8.7e-191 88.2 rCG52691 [Rattu... Rattus norvegicus XP_516708 1e-159 75.0 HEG homolog 1 [... Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

No significant homologues

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001438	294	305	PR00010	Type II EGF-like signature
	IPR001438	314	324	PR00010	Type II EGF-like signature
HMMPfam	IPR006209	258	291	PF00008	EGF-like
	IPR001881	294	331	PF07645	EGF-like calcium-binding
HMMSmart	IPR001881	254	292	SM00179	EGF-like calcium-binding
	IPR006210	257	292	SM00181	Type I EGF
	IPR001881	294	332	SM00179	EGF-like calcium-binding
	IPR006210	297	332	SM00181	Type I EGF
	IPR006210	452	500	SM00181	Type I EGF
ProfileScan	NULL	294	332	PS50034	NULL
ScanRegExp	IPR006209	280	291	PS00022	EGF-like
	IPR001881	287	318	PS01187	EGF-like calcium-binding
	IPR000152	309	320	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR006209	318	331	PS01186	EGF-like

Method	From	To	amino acid sequence
SOSUI	518	540	ITVVIAAAGGGLLLILGVALIVT