ROUGE |
Gene/Protein Characteristic Table for mKIAA1222 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122472 |
---|---|
protein phosphatase 1, regulatory (inhibitor) subunit 9A. neurabin. neural tissue-specific F-actin binding protein. |
|
mbg06326 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6451 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5262 bp Genome contig ID gi65504368f_4966485 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TGGCCAGAAATACCCTAAATTGCCTTTACCCAAAGFlanking genome sequence
(151418 - 151467) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAGCAGGAAGCGATGCCCAGGCCAGATAGC
KIAA Alignment based on: KIAA1222 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1189
Length: 395 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |