ROUGE

Gene/Protein Characteristic Table for mKIAA1222

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122472
Description :	protein phosphatase 1, regulatory (inhibitor) subunit 9A. neurabin. neural tissue-specific F-actin binding protein.
Clone Name :	mbg06326 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6451 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5262 bp

Genome contig ID gi65504368f_4966485
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGCCAGAAATACCCTAAATTGCCTTTACCCAAAG
Flanking genome sequence
(151418 - 151467)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAGCAGGAAGCGATGCCCAGGCCAGATAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1222 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1222	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1189
Length: 395 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC77245	1.6e-126	100.0	neural tissue-s...	Mus musculus
O35867	4.1e-123	97.2	Neurabin-1; Neu...	Rattus norvegicus
XP_860839	8.1e-118	93.4	similar to Neur...	Canis lupus fam...
EAW76775	9.5e-118	94.1	hCG1741805, iso...	Homo sapiens
XP_001169436	1.3e-117	94.1	protein phospha...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011510 286 352 PF07647 Sterile alpha motif homology 2

IPR001660 287 350 PF00536 Sterile alpha motif SAM

HMMSmart IPR001660 286 352 SM00454 Sterile alpha motif SAM

ProfileScan IPR001660 289 352 PS50105 Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	286	352	PF07647	Sterile alpha motif homology 2
IPR001660	287	350	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	286	352	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	289	352	PS50105	Sterile alpha motif SAM

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5262 bp
Genome contig ID	gi65504368f_4966485
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGCCAGAAATACCCTAAATTGCCTTTACCCAAAG
Flanking genome sequence (151418 - 151467)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAGCAGGAAGCGATGCCCAGGCCAGATAGC

Gene/Protein Characteristic Table for mKIAA1222

Features of the cloned DNA sequence

Features of the protein sequence