ROUGE |
Gene/Protein Characteristic Table for mKIAA1214 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220374 |
---|---|
ring finger protein 150. | |
mbg16803 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5290 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3892 bp Genome contig ID gi65515060f_82004650 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTTAAAAATTTTGAACAATAATGTATAGGCAGAGTFlanking genome sequence
(231166 - 231215) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAATAACTATGAGGGCTGGAGAAATGGCTCAGCATTTCCAG
KIAA Alignment based on: KIAA1214 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 205..1398
Length: 397 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |