ROUGE

Gene/Protein Characteristic Table for mKIAA1203

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122466
Description :
Clone Name :	mbg08582 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 7017 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 6161 bp

Genome contig ID gi65511124r_115417589
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
ACATAATAAATTTATTACATGATGCCTTCTTCAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATATTTGTCTTTTCTCTCCCTTGCCAAACCAGTTTTTAAAATGTTGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1203 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1203	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..856
Length: 284 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL17250	6.3e-81	100.0	mCG67204 [Mus m...	Mus musculus
XP_357781	6.7e-81	100.0	ubiquitin speci...	Mus musculus
EDM17581	4.1e-77	95.1	ubiquitin speci...	Rattus norvegicus
BAG52610	1.2e-64	80.8	unnamed protein...	Homo sapiens
EAW55836	1.6e-64	80.8	ubiquitin speci...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 8 280 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	8	280	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	6161 bp
Genome contig ID	gi65511124r_115417589
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ACATAATAAATTTATTACATGATGCCTTCTTCAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATATTTGTCTTTTCTCTCCCTTGCCAAACCAGTTTTTAAAATGTTGAA

Gene/Protein Characteristic Table for mKIAA1203

Features of the cloned DNA sequence

Features of the protein sequence