KIAA1203

Product ID	ORK07314
Accession No	AB033029
Description	ubiquitin specific peptidase 31
Clone name	fg03361
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6111 bp) Predicted protein sequence (727 aa)
Source	Human fetal brain
Rouge ID	mKIAA1203 by Kazusa Mouse cDNA Project

Length: 6111 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3927 bp
Genome contig ID	gi51511732r_22882940
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCATAAGCACAGTTTCAATAAAACACGTATTCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTGCGTGGAACTTTGTATTATTTGTAGTTGAGAAAGGCAAACTTTGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	22982940	23001334	5	99.1	Perfect prediction

Length: 727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW55836	1.7e-203	100.0	ubiquitin speci...	Homo sapiens
EAW55835	1.9e-203	100.0	ubiquitin speci...	Homo sapiens
CAE51935	2.2e-203	100.0	ubiquitin-speci...	Homo sapiens
Q70CQ4	2.2e-203	100.0	Ubiquitin carbo...	Homo sapiens
XP_001087999	1.7e-198	97.1	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	2	137	PF00443	Peptidase C19
ProfileScan	IPR001394	1	141	PS50235	Peptidase C19
ScanRegExp	IPR001394	82	99	PS00973	Peptidase C19

Primer_f	CACATAGAGGGGCATCAGACG
Primer_r	GAAACTGTGCTTATGACTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-