ROUGE

Gene/Protein Characteristic Table for mKIAA1179

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122461
Description :	intraflagellar transport 172 protein. wimple. selective LIM-binding factor Wimple.
Clone Name :	mbg05639 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5974 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4491 bp

Genome contig ID gi65498774r_29612220
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TACATCTGTCCCTCATTAAAGTTCTCTGAGTAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGACTGCTGCATTCTTTGCTCAATGTCTCTCCACCACAGCACACTGCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1179 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1179	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1306, 1833..2294, 4060..4827, 4943..5920
Length: 1170 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX00575	87.2	intraflagellar ...	Homo sapiens
EAX00574	87.4	intraflagellar ...	Homo sapiens
EAX00572	88.5	intraflagellar ...	Homo sapiens
Q6VH22	93.5	Intraflagellar ...	Mus musculus
EDL37361	93.5	intraflagellar ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129413	7.2e-05	21.8	mKIAA1638

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4491 bp
Genome contig ID	gi65498774r_29612220
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TACATCTGTCCCTCATTAAAGTTCTCTGAGTAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGACTGCTGCATTCTTTGCTCAATGTCTCTCCACCACAGCACACTGCCC

Gene/Protein Characteristic Table for mKIAA1179

Features of the cloned DNA sequence

Features of the protein sequence