Order Kazusa clone(s) from : ![]() |
Product ID | ORK05493 |
---|---|
Accession No | AB033005 |
Description | intraflagellar transport 172 |
Clone name | hh05402a |
Vector information | |
cDNA sequence | DNA sequence (3326 bp) Predicted protein sequence (1090 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1179
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 53 bp |
---|---|
Genome contig ID | gi89161199r_27420750 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 27520750 | 27539512 | 30 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TATGGCGGAGAAGGAACAGAC |
---|---|
Primer_r | TTCAGCCACAGCGATACACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TATGGCGGAGAAGGAACAGAC |
Primer_r | TTCAGCCACAGCGATACACTC |
PCR product length | 168 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |