Gene/Protein Characteristic Table for mKIAA1172

Length: 4364 bp

Restriction map

Length of 3'UTR	341 bp
Genome contig ID	gi65546577r_89286390
PolyA signal sequence (AATAAA,-18)	+----*----+----*----+----*----+---- ACCATAGGGATGTTTTTAATAAACTCTATTTTCGT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AACAAACGTTAATGTGTGCTATTCTTCATACACTGCAGTGAGATGGAACG

KIAA	Alignment based on:
KIAA1172	DNA sequence, AA sequence, Physical map

Coding region: 421..4023

Length: 1200 aa

Entry Exp ID% Protein Source EDK98387 0 99.7 mCG129573, isof... Mus musculus AAH53096 0 99.7 Sfrs15 protein ... Mus musculus NP_001032424 0 92.8 splicing factor... Rattus norvegicus AAH57592 3.8e-198 97.4 Splicing factor... Mus musculus Q63627 1.2e-195 91.9 Splicing factor... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122451 1.1e-20 37.2 mKIAA1116 AK173178 0.0008 32.2 mKIAA1471

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	589	656	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	588	657	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	NULL	207	260	PS50322	NULL
	IPR000694	302	491	PS50099	Proline-rich region
	NULL	339	494	PS50322	NULL
	NULL	515	570	PS50323	NULL
	IPR000504	587	661	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000694	733	1036	PS50099	Proline-rich region
	NULL	998	1045	PS50322	NULL
	NULL	1039	1125	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-