| ROUGE | 
Gene/Protein Characteristic Table for mKIAA1143 | 
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220157 | 
|---|---|
| mek02751 [Vector Info] | |
| Source : | Mouse embryonic intestinal tract | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 720 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | YES | 
Warning for coding interruption:  | NO | 
Length of 3'UTR 356 bp Genome contig ID gi65519420r_122865312 PolyA signal sequence 
(ATTAAA,-29) +----*----+----*----+----*----+----
TCTAACATTAAAGGCTTCCAGAGGATTTCATAAATFlanking genome sequence 
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGATCTGTCTTAGTCACTGTTCTGTTGCTGAGAAGAGATGACATGACAGC
KIAA Alignment based on: KIAA1143 DNA sequence, AA sequence, Physical map 
Features of the protein sequence | 
Description | |
Coding region: 2..364
Length: 120 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| None | - | - | - | - | - | 
| Method | From | To | amino acid sequence | 
|---|---|---|---|
| - | - | - | - | 
| 
 
 How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage  
 
  | |