KIAA1143

Product ID	ORK05637
Accession No	AB032969
Description	Uncharacterized protein KIAA1143.
Clone name	hj00512
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4946 bp) Predicted protein sequence (116 aa)
Source	Human adult brain
Rouge ID	mKIAA1143 by Kazusa Mouse cDNA Project

Length: 4946 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4595 bp
Genome contig ID	gi89161205r_44665351
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGCCTACTAAGTGCACAATAAACATAGTTAAAATG
Flanking genome sequence (99891 - 99842)	----+--------+--------+--------+--------+----* AATGAGAGTGTTGTCTGTAATTTTCTTTTTATAGATGAGTAGGTCTCATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	44765242	44770858	2	99.0	Perfect prediction
Ensembl gnome browser	14	r	31806223	31811162	1	98.0	Perfect prediction

Length: 116 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW65934	1.5e-39	98.3	hCG1639915 [Hom...	Homo sapiens
XP_001105000	1.2e-38	96.6	similar to T25G...	Macaca mulatta
BAB23258	9.3e-33	86.3	unnamed protein...	Mus musculus
XP_533861	1.8e-32	88.7	similar to T25G...	Canis lupus fam...
NP_001016005	3.1e-19	60.0	hypothetical pr...	Xenopus (Silura...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	TGTGGATGAGCTAGGAAGACC
Primer_r	CCCACACCCAGATACTAAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	TGTGGATGAGCTAGGAAGACC
Primer_r	CCCACACCCAGATACTAAGAC
PCR product length	215 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles