ROUGE |
Gene/Protein Characteristic Table for mKIAA1138 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173108 |
---|---|
transcription elongation factor B polypeptide 3 binding protein 1. elongin A binding protein 1. |
|
mfj23063 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5214 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1467 bp Genome contig ID gi65524842r_80572076 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
ACAAGTTTTTAAAAACAAATAAATGGTGCTAATGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTCACAAAGCCCAGGTCTGTCCTGGGAGCTTTAGTGTGTGTCTCTGCCT
KIAA Alignment based on: KIAA1138 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 49..3747
Length: 1232 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |