ROUGE

Gene/Protein Characteristic Table for mKIAA1105

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173099
Description :	Similar to retinoblastoma-associated protein RAP140.
Clone Name :	mej01470 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 3044 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2164 bp

Genome contig ID gi65540054f_25515419
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TTTTAAATAAAAGTTGTCTTAATATGCAAAAAAAC
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1105 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1105	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..880
Length: 292 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL24728	7.5e-117	100.0	mCG117568, isof...	Mus musculus
Q69ZR9	8.4e-117	100.0	Uncharacterized...	Mus musculus
NP_001108351	8.6e-117	100.0	retinoblastoma-...	Mus musculus
EDL75058	1.8e-107	93.2	rCG39181 [Rattu...	Rattus norvegicus
XP_001055601	2e-107	93.2	similar to reti...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220437	1.3e-07	33.6	mKIAA2006

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2164 bp
Genome contig ID	gi65540054f_25515419
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TTTTAAATAAAAGTTGTCTTAATATGCAAAAAAAC
Flanking genome sequence	None

Gene/Protein Characteristic Table for mKIAA1105

Features of the cloned DNA sequence

Features of the protein sequence