ROUGE

Gene/Protein Characteristic Table for mKIAA1086

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122438
Description :
Clone Name :	mbg09268 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5974 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2191 bp

Genome contig ID gi65524842f_81277805
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGGCTAGGGTGGGGAATAAAGCAGATCTGCCCGTG
Flanking genome sequence
(110448 - 110497)
----+----*----+----*----+----*----+----*----+----*
TGCGCTGTGGCCTTCATGTCCTTCACTCAGGGGTCCAGGTGGCCATACCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1086 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1086	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2005..2298, 2923..3780, 4378..4587
Length: 454 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL31443	4.7e-141	88.4	mCG134265, isof...	Mus musculus
EDL31445	4.8e-141	88.4	mCG134265, isof...	Mus musculus
EDL31442	4.9e-141	92.4	mCG134265, isof...	Mus musculus
EDL31444	5e-141	92.4	mCG134265, isof...	Mus musculus
NP_001030067	5e-141	93.5	zinc finger RNA...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006561 260 454 PF07528 DZF

HMMSmart IPR003604 66 100 SM00451 Zinc finger

ProfileScan IPR006116 213 302 PS50152 2-5 oligoadenylate synthetase

ScanRegExp IPR007087 71 93 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006561	260	454	PF07528	DZF
HMMSmart	IPR003604	66	100	SM00451	Zinc finger
ProfileScan	IPR006116	213	302	PS50152	2-5 oligoadenylate synthetase
ScanRegExp	IPR007087	71	93	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2191 bp
Genome contig ID	gi65524842f_81277805
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGGCTAGGGTGGGGAATAAAGCAGATCTGCCCGTG
Flanking genome sequence (110448 - 110497)	----+--------+--------+--------+--------+----* TGCGCTGTGGCCTTCATGTCCTTCACTCAGGGGTCCAGGTGGCCATACCC

Gene/Protein Characteristic Table for mKIAA1086

Features of the cloned DNA sequence

Features of the protein sequence