KIAA1086

Product ID	ORK05633
Accession No	AB029009
Description	zinc finger RNA binding protein 2
Clone name	hj08218
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4635 bp) Predicted protein sequence (902 aa)
Flexi ORF Clone	FXC05633
Source	Human adult brain
Rouge ID	mKIAA1086 by Kazusa Mouse cDNA Project

Length: 4635 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1925 bp
Genome contig ID	gi42406306r_3655022
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGGGAGGCAGGGGGAATAAAGGAAATCATTTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTGTGTGAGCCGTGCCGTCCTTCCTGCGGGGTGCAGGTGACCCCAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	3755022	3785924	18	99.5	Perfect prediction

Length: 902 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPR6	0	100.0	Zinc finger RNA...	Homo sapiens
NP_055989	0	99.9	zinc finger RNA...	Homo sapiens
EAW69282	0	99.8	hCG23534, isofo...	Homo sapiens
EAW69283	0	99.8	hCG23534, isofo...	Homo sapiens
NP_001030067	6.8e-109	52.7	zinc finger RNA...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006561	621	867	PF07528	DZF
HMMSmart	IPR003604	231	265	SM00451	Zinc finger
	IPR015880	234	258	SM00355	Zinc finger
	IPR003604	279	313	SM00451	Zinc finger
	IPR015880	282	306	SM00355	Zinc finger
	IPR003604	428	462	SM00451	Zinc finger
	IPR015880	431	455	SM00355	Zinc finger
	IPR006561	615	867	SM00572	DZF
ScanRegExp	IPR007087	236	258	PS00028	Zinc finger
	IPR007087	284	306	PS00028	Zinc finger
	IPR007087	433	455	PS00028	Zinc finger

Primer_f	CAACCTGTTCAAACCTTCCGC
Primer_r	TTCAGACAGAGCCACATGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAACCTGTTCAAACCTTCCGC
Primer_r	TTCAGACAGAGCCACATGCAG
PCR product length	164 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles