| ROUGE | 
| Gene/Protein Characteristic Table for mKIAA1084 | 
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129283 | 
|---|---|
| mpf00327 [Vector Info] | |
| Source : | Mouse embryonic tail | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 6646 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 3603 bp Genome contig ID gi65511124r_30835200 PolyA signal sequence 
(AATAAA,-17)
TAAATATTGTATTTTGGTAATAAATTTTTTTTGTTFlanking genome sequence 
(99989 - 99940)
AAAAAACCACTTGTTTCTAAGTTTCCTTAGCTGTCTGCGTGTATTCCTGT
KIAA Alignment based on: KIAA1084 DNA sequence, AA sequence, Physical map 
| Features of the protein sequence | Description | |
Coding region: 2..3043
Length: 1013 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage   | |