ROUGE

Gene/Protein Characteristic Table for mKIAA1063

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220368
Description :	Similar to ubiquitin specific protease (Fragment).
Clone Name :	mfj05092 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4242 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2529 bp

Genome contig ID gi65527427r_60777584
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATTTATTATAGCTTTGAAATAAAAAATCGTGAGGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAATCCAATGATTGTACTGTGGTTAGGAGTTTTATTACCAAGACA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1063 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1063	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1713
Length: 570 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5DU02	0	100.0	Ubiquitin carbo...	Mus musculus
AAH80737	0	99.8	Ubiquitin speci...	Mus musculus
BAE36137	0	99.8	unnamed protein...	Mus musculus
Q9UPT9	5.8e-216	97.9	Ubiquitin carbo...	Homo sapiens
XP_586712	6e-214	93.1	similar to ubiq...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122195	4.5e-12	29.2	mKIAA0055
AK129363	5.2e-12	28.6	mKIAA1453
AK173083	2.7e-09	28.8	mKIAA1003
AK122442	1.4e-06	24.2	mKIAA1097
AK122396	2.8e-06	27.9	mKIAA0891

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 218 562 PF00443 Peptidase C19

ProfileScan IPR001394 221 566 PS50235 Peptidase C19

ScanRegExp IPR001394 222 237 PS00972 Peptidase C19

IPR001394 508 525 PS00973 Peptidase C19

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	218	562	PF00443	Peptidase C19
ProfileScan	IPR001394	221	566	PS50235	Peptidase C19
ScanRegExp	IPR001394	222	237	PS00972	Peptidase C19
IPR001394	508	525	PS00973	Peptidase C19

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2529 bp
Genome contig ID	gi65527427r_60777584
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATTTATTATAGCTTTGAAATAAAAAATCGTGAGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAATCCAATGATTGTACTGTGGTTAGGAGTTTTATTACCAAGACA

Gene/Protein Characteristic Table for mKIAA1063

Features of the cloned DNA sequence

Features of the protein sequence