ROUGE |
Gene/Protein Characteristic Table for mKIAA0994 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | D16580 |
---|---|
Protein-arginine deiminase type II. | |
mbh02401 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3825 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2654 bp Genome contig ID gi65493515f_139714007 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CAAAATAAAGAGCAATAAAATAAGCCGTCCACGGGFlanking genome sequence
(119837 - 119886) ----+----*----+----*----+----*----+----*----+----*
AAGCTACGCGGCTCTGGGTGACATTCTTTGCGGCTTCTGAGACATAGACA
KIAA Alignment based on: KIAA0994 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1171
Length: 389 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |