ROUGE

Gene/Protein Characteristic Table for mKIAA0988

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093276
Description :	tubulin-specific chaperone d.
Clone Name :	mbg01068 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4833 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 218 bp

Genome contig ID gi65527427f_121319410
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CACAGACGTGCTTCTCATTAAATCATGTATCACAC
Flanking genome sequence
(118849 - 118898)
----+----*----+----*----+----*----+----*----+----*
AGCCCAGCCTCTGCCTATCTCTGGGACGTCCGTGCACAAGGAGCTGGAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0988 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0988	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3557..4615
Length: 352 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL34841	9e-137	100.0	tubulin-specifi...	Mus musculus
Q8BYA0	9.2e-137	100.0	Tubulin-specifi...	Mus musculus
EDL34842	9.4e-137	100.0	tubulin-specifi...	Mus musculus
XP_343650	1.2e-133	96.9	similar to tubu...	Rattus norvegicus
EDM06952	1.9e-133	96.9	rCG35584 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	218 bp
Genome contig ID	gi65527427f_121319410
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CACAGACGTGCTTCTCATTAAATCATGTATCACAC
Flanking genome sequence (118849 - 118898)	----+--------+--------+--------+--------+----* AGCCCAGCCTCTGCCTATCTCTGGGACGTCCGTGCACAAGGAGCTGGAGG

Gene/Protein Characteristic Table for mKIAA0988

Features of the cloned DNA sequence

Features of the protein sequence