KIAA0988

Gene/Protein Characteristic Table for KIAA0988

Order Kazusa clone(s) from :

Product ID	ORK00708
Accession No	AB023205
Description	tubulin folding cofactor D
Clone name	hk04388
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3927 bp) Predicted protein sequence (1210 aa)
HaloTag ORF Clone	FHC00708
Flexi ORF Clone	FXC00708
Source	Human adult brain
Rouge ID	mKIAA0988 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3927 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	239 bp
Genome contig ID	gi51511734f_78203250
PolyA signal sequence (TATAAA,-19)	+--------+--------+----*----+---- ACACAAATGTGCTTCCTATAAAATCATGTACCAAG
Flanking genome sequence (290619 - 290668)	----+--------+--------+--------+--------+----* AAGTTCCTGCCTTTTGTCTCTGAGCCTGATGTGTGTAGGGGTGATGGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	78303250	78493867	39	99.8	Perfect prediction

Features of the protein sequence

Description

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09930	100.0	tubulin-specifi...	synthetic construct
Q9BTW9	99.9	Tubulin-specifi...	Homo sapiens
NP_005984	99.8	beta-tubulin co...	Homo sapiens
XP_001169003	97.2	beta-tubulin co...	Pan troglodytes
CAA07022	96.0	beta-tubulin co...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	374	409	PF02985	HEAT

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGTGTGACCTTCTGGGCGTAC
Primer_r	TCAAGTGAAGGCAGAGGCGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp