ROUGE

Gene/Protein Characteristic Table for mKIAA0979

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122414
Description :	androgen-induced prostate proliferative shutoff associated protein AS3.
Clone Name :	mbx00002 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5944 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2367 bp

Genome contig ID gi65498774f_149577657
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ACATACTTTAAAATAAAGCTAAGTATGTATACGAC
Flanking genome sequence
(173878 - 173927)
----+----*----+----*----+----*----+----*----+----*
ATTAATTGCTACAGTTGTTAGCATACTGCAGTGGTCGTACTCATTTTGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0979 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0979	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3577
Length: 1191 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q4VA53	100.0	Sister chromati...	Mus musculus
AAM52216	99.7	androgen-induce...	Mus musculus
Q6TRW4	97.8	Sister chromati...	Rattus norvegicus
XP_543139	95.9	similar to andr...	Canis lupus fam...
EAX08518	95.5	hCG32806, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172992	9.7e-144	75.9	mKIAA0648

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 1030 1040 PR00929 HMG-I and HMG-Y

IPR000637 1113 1124 PR00929 HMG-I and HMG-Y

HMMPfam IPR000357 128 164 PF02985 HEAT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	1030	1040	PR00929	HMG-I and HMG-Y
IPR000637	1113	1124	PR00929	HMG-I and HMG-Y
HMMPfam	IPR000357	128	164	PF02985	HEAT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2367 bp
Genome contig ID	gi65498774f_149577657
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ACATACTTTAAAATAAAGCTAAGTATGTATACGAC
Flanking genome sequence (173878 - 173927)	----+--------+--------+--------+--------+----* ATTAATTGCTACAGTTGTTAGCATACTGCAGTGGTCGTACTCATTTTGAG

Gene/Protein Characteristic Table for mKIAA0979

Features of the cloned DNA sequence

Features of the protein sequence