ROUGE

Gene/Protein Characteristic Table for mKIAA0648

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172992
Description :
Clone Name :	meh01005 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 5275 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2565 bp

Genome contig ID gi65498774r_64324715
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGTGACGAATATTGGATAGTTTTAAGGTCAGAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGCCTCTAAACTTATTGAGGAATGGAAGACAGGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0648 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0648	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 158..2704, 4362..5180
Length: 1122 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6A026	99.9	Sister chromati...	Mus musculus
NP_001074790	99.5	PDS5, regulator...	Mus musculus
EDL37752	99.5	mCG10267 [Mus m...	Mus musculus
A4L9P7	99.2	Sister chromati...	Rattus norvegicus
Q29RF7	99.0	Sister chromati...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122414	0	75.9	mKIAA0979

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 402 438 PF02985 HEAT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	402	438	PF02985	HEAT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2565 bp
Genome contig ID	gi65498774r_64324715
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGTGACGAATATTGGATAGTTTTAAGGTCAGAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGCCTCTAAACTTATTGAGGAATGGAAGACAGGTT

Gene/Protein Characteristic Table for mKIAA0648

Features of the cloned DNA sequence

Features of the protein sequence