ROUGE |
Gene/Protein Characteristic Table for mKIAA0974 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129252 |
---|---|
mpj02408 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1828 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 505 bp Genome contig ID gi65540054f_18609616 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATATATTCATCAAATAAATGTCATTCCTAAACTTTFlanking genome sequence
(135188 - 135237) ----+----*----+----*----+----*----+----*----+----*
AAGTTCTTTATTACATTTTAGATGTATTTTTGTGTGTATGAATGGCGGGG
KIAA Alignment based on: KIAA0974 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 214..1323
Length: 369 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |