Gene/Protein Characteristic Table for KIAA0974
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05628
Accession No AB023191
Description family with sequence similarity 149, member B1
Clone name hj06874
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5183 bp)
Predicted protein sequence (565 aa)
Source Human adult brain
Rouge ID mKIAA0974 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5183 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 3485 bp
Genome contig ID gi89161187f_74504455
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGGTGATGGAGATGCCATCTCTTAGAAAAAAGAG
Flanking genome sequence
(169815 - 169864)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGGCAAATGATGCAATTGCCAGGATACAGGTATTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 10 f 74604455 74674268 13 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 565 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96BN6 0 100.0 Protein FAM149B1.
Homo sapiens
XP_001103228 1.2e-207 94.3 hypothetical pr...
Macaca mulatta
EAW54481 6.9e-204 94.7 hCG2024499, iso...
Homo sapiens
XP_001502947 3.1e-191 87.9 hypothetical pr...
Equus caballus
BAG64484 4.9e-190 99.2 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAAATGTCACCACCAAGTTCC
Primer_r AGGTGCAGGCAGGATTTGAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp