KIAA0974

Gene/Protein Characteristic Table for KIAA0974

Order Kazusa clone(s) from :

Product ID	ORK05628
Accession No	AB023191
Description	family with sequence similarity 149, member B1
Clone name	hj06874
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5183 bp) Predicted protein sequence (565 aa)
Source	Human adult brain
Rouge ID	mKIAA0974 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5183 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3485 bp
Genome contig ID	gi89161187f_74504455
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGGTGATGGAGATGCCATCTCTTAGAAAAAAGAG
Flanking genome sequence (169815 - 169864)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGGCAAATGATGCAATTGCCAGGATACAGGTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	74604455	74674268	13	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 565 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96BN6	0	100.0	Protein FAM149B1.	Homo sapiens
XP_001103228	1.2e-207	94.3	hypothetical pr...	Macaca mulatta
EAW54481	6.9e-204	94.7	hCG2024499, iso...	Homo sapiens
XP_001502947	3.1e-191	87.9	hypothetical pr...	Equus caballus
BAG64484	4.9e-190	99.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CAAATGTCACCACCAAGTTCC
Primer_r	AGGTGCAGGCAGGATTTGAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 10

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp