ROUGE

Gene/Protein Characteristic Table for mKIAA0917

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129238
Description :	RSLY1P homolog.
Clone Name :	mpf00462 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6841 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 6345 bp

Genome contig ID gi65532617f_48029006
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAGCCTTCAGAAGGTTAAAAAAAAAAAAAAAAAA
Flanking genome sequence
(124038 - 124087)
----+----*----+----*----+----*----+----*----+----*
GCACTCTACAGTAAAATGCTGATGACCAGGACTGAGATTTTAAAACCAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0917 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0917	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 2..496
Length: 164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC30788	3.1e-50	97.7	unnamed protein...	Mus musculus
AAH27793	4.3e-50	97.7	Scfd1 protein [...	Mus musculus
BAB29141	4.7e-50	97.7	unnamed protein...	Mus musculus
Q8BRF7	4.7e-50	97.7	Sec1 family dom...	Mus musculus
AAP97146	6.3e-50	96.9	sly1p [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	6345 bp
Genome contig ID	gi65532617f_48029006
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAGCCTTCAGAAGGTTAAAAAAAAAAAAAAAAAA
Flanking genome sequence (124038 - 124087)	----+--------+--------+--------+--------+----* GCACTCTACAGTAAAATGCTGATGACCAGGACTGAGATTTTAAAACCAGA

Gene/Protein Characteristic Table for mKIAA0917

Features of the cloned DNA sequence

Features of the protein sequence