KIAA0917

Product ID	ORK02003
Accession No	AB020724
Description	sec1 family domain containing 1, transcript variant 1
Clone name	hk07974s2
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-563) was subcloned upstream of the cDNA (564-2135). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGT-5' end of cDNA
cDNA sequence	DNA sequence (2135 bp) Predicted protein sequence (648 aa)
HaloTag ORF Clone	FHC02003
Flexi ORF Clone	FXC02003
Source	Human adult brain
Rouge ID	mKIAA0917 by Kazusa Mouse cDNA Project
Note	We replaced hk07974, former representative clones for KIAA0917 with hk07974s2. (2003/8/28)

Length: 2135 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	186 bp
Genome contig ID	gi51511730f_30061276
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TAATATGTATTGATTAAAAGAAACATTTCAGAAAT
Flanking genome sequence (213478 - 213527)	----+--------+--------+--------+--------+----* AAAATTTCAACATTGTTCATTTTCTCTGATAAATCAGAAAGTACTAATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	30161276	30274752	25	100.0	Perfect prediction

Length: 648 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509885	99.8	vesicle transpo...	Pan troglodytes
Q8WVM8	100.0	Sec1 family dom...	Homo sapiens
AAG50273	99.8	vesicle transpo...	Homo sapiens
AAH17734	99.8	Sec1 family dom...	Homo sapiens
BAD96540	99.8	vesicle transpo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001619	49	642	PF00995	Sec1-like protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	WLVGAKMAAAAAATAAAAASI	21	PRIMARY	21

Primer_f	TGGAGATGAAGTCAAACCCCG
Primer_r	ATGTAGTTGCCTCCTCCCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-