Gene/Protein Characteristic Table for mKIAA0909

Length: 4288 bp

Restriction map

Length of 3'UTR	736 bp
Genome contig ID	gi65527427r_70295122
PolyA signal sequence (ATTAAA,-22)	+----*----+----*----+----*----+---- TATACGAATTGCCATTAAACGTCTCTGCACCAGCT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AGCCTCCGGCCTCTCTCTGCTGGGGGCGGGGTAGGAAGGTCGCCACGCAA

KIAA	Alignment based on:
KIAA0909	DNA sequence, AA sequence, Physical map

Coding region: 1..3552

Length: 1183 aa

Entry Exp ID% Protein Source AAH56395 0 100.0 Camta2 protein ... Mus musculus EDL12604 0 100.0 calmodulin bind... Mus musculus EDL12603 0 100.0 calmodulin bind... Mus musculus Q80Y50 0 99.6 Calmodulin-bind... Mus musculus EDL12605 0 99.6 calmodulin bind... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122383 3e-16 40.4 mKIAA0833

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005559	13	130	PF03859	CG-1
	IPR002909	515	597	PF01833	Cell surface receptor IPT/TIG
	IPR000048	1083	1103	PF00612	IQ calmodulin-binding region
ProfileScan	IPR000694	249	459	PS50099	Proline-rich region
	NULL	269	280	PS50324	NULL
	IPR002110	692	791	PS50297	Ankyrin
	IPR000048	1082	1108	PS50096	IQ calmodulin-binding region

Method	From	To	amino acid sequence
-	-	-	-