Order Kazusa clone(s) from : ![]() |
Product ID | ORK01135 |
---|---|
Accession No | AB020716 |
Description | calmodulin binding transcription activator 2, transcript variant 1 |
Clone name | hk10471 |
Vector information | |
cDNA sequence | DNA sequence (4465 bp) Predicted protein sequence (1234 aa) |
HaloTag ORF Clone |
FHC01135
![]() |
Flexi ORF Clone | FXC01135 |
Source | Human adult brain |
Rouge ID |
mKIAA0909
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 758 bp |
---|---|
Genome contig ID | gi51511734r_4712017 |
PolyA signal sequence (ATTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 4812017 | 4831645 | 23 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005559 | 66 | 182 | PF03859 | CG-1 |
IPR002909 | 565 | 646 | PF01833 | Cell surface receptor IPT/TIG | |
IPR002110 | 742 | 762 | PF00023 | Ankyrin | |
IPR002110 | 787 | 807 | PF00023 | Ankyrin | |
IPR002110 | 821 | 841 | PF00023 | Ankyrin | |
IPR000048 | 1134 | 1154 | PF00612 | IQ calmodulin-binding region | |
ProfileScan | IPR002110 | 742 | 841 | PS50297 | Ankyrin |
IPR000048 | 1133 | 1159 | PS50096 | IQ calmodulin-binding region |
![]() |
Primer_f | GGAGGGGTCTTGTACATACTG |
---|---|
Primer_r | AAGTAGAAAGTGCCCGTGGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGAGGGGTCTTGTACATACTG |
Primer_r | AAGTAGAAAGTGCCCGTGGAG |
PCR product length | 141 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |