KIAA0909

Product ID	ORK01135
Accession No	AB020716
Description	calmodulin binding transcription activator 2, transcript variant 1
Clone name	hk10471
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4465 bp) Predicted protein sequence (1234 aa)
HaloTag ORF Clone	FHC01135
Flexi ORF Clone	FXC01135
Source	Human adult brain
Rouge ID	mKIAA0909 by Kazusa Mouse cDNA Project

Length: 4465 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	758 bp
Genome contig ID	gi51511734r_4712017
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GGTTTATACGAATTGCCATTAAACATCGCTGCACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCAGCCTCCGGCCTCTGTCTGCGGGGGCGGGGCGGGGCCTAGGCCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	4812017	4831645	23	99.5	Perfect prediction

Length: 1234 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11256	100.0	calmodulin-bind...	synthetic construct
EAW90372	99.9	hCG1986010, iso...	Homo sapiens
O94983	99.8	Calmodulin-bind...	Homo sapiens
AAI42696	99.7	Calmodulin bind...	Homo sapiens
EAW90371	99.3	hCG1986010, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020640	1.2e-33	42.3	KIAA0833

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005559	66	182	PF03859	CG-1
	IPR002909	565	646	PF01833	Cell surface receptor IPT/TIG
	IPR002110	742	762	PF00023	Ankyrin
	IPR002110	787	807	PF00023	Ankyrin
	IPR002110	821	841	PF00023	Ankyrin
	IPR000048	1134	1154	PF00612	IQ calmodulin-binding region
ProfileScan	IPR002110	742	841	PS50297	Ankyrin
ProfileScan	IPR000048	1133	1159	PS50096	IQ calmodulin-binding region

Primer_f	GGAGGGGTCTTGTACATACTG
Primer_r	AAGTAGAAAGTGCCCGTGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGAGGGGTCTTGTACATACTG
Primer_r	AAGTAGAAAGTGCCCGTGGAG
PCR product length	141 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles