Gene/Protein Characteristic Table for mKIAA0902

Length: 5338 bp

Restriction map

Length of 3'UTR	2045 bp
Genome contig ID	gi66880665r_151321008
PolyA signal sequence (ATTAAA,-18)	+----*----+----*----+----*----+---- TACTGGTAAAAAAAAAAATTAAACTAATGAATTTT
Flanking genome sequence (99972 - 99923)	----+----*----+----*----+----*----+----*----+----* ATAAGACTGGTGAGTTATAAGACTAGCCTAGCATGAAAGAGACCTTTTAA

KIAA	Alignment based on:
KIAA0902	DNA sequence, AA sequence, Physical map

Coding region: 117..3293

Length: 1058 aa

Entry Exp ID% Protein Source EDL40826 0 100.0 connector enhan... Mus musculus EDL96123 0 99.2 connector enhan... Rattus norvegicus BAG57875 0 98.9 unnamed protein... Homo sapiens CAH92154 0 98.9 hypothetical pr... Pongo abelii AAH72753 0 81.4 MGC79120 protei... Xenopus laevis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220339 1.1e-17 36.1 mKIAA0403 AK129423 3.9e-05 33.9 mKIAA1686

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	83	151	PF07647	Sterile alpha motif homology 2
	IPR001660	84	148	PF00536	Sterile alpha motif SAM
	IPR010599	358	541	PF06663	Connector enhancer of kinase suppressor of ras 2
	IPR001849	597	695	PF00169	Pleckstrin-like
HMMSmart	IPR001660	83	151	SM00454	Sterile alpha motif SAM
	IPR001849	597	697	SM00233	Pleckstrin-like
ProfileScan	IPR001660	86	151	PS50105	Sterile alpha motif SAM
	IPR001478	290	345	PS50106	PDZ/DHR/GLGF
	IPR001849	596	695	PS50003	Pleckstrin-like
	NULL	901	927	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-