ROUGE

Gene/Protein Characteristic Table for mKIAA0860

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK049276
Description :	RING finger protein 37.
Clone Name :	mbp00020 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1684 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 64 bp

Genome contig ID gi66880554r_130005596
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTGGGGGAGACCTGAAGGTGGAGGAAGCAAGAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGACCCCAGTGCCTCTGTTCTCTCTTGGGCTTGAATACCTCATGGTGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0860 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0860	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1620
Length: 539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q925F4	2.1e-209	100.0	RING finger pro...	Mus musculus
AAK51467	7.3e-209	99.8	UbcM4-interacti...	Mus musculus
BAE34338	7.3e-209	99.8	unnamed protein...	Mus musculus
AAH25068	9.7e-209	99.8	Ubox5 protein [...	Mus musculus
AAY21061	8e-207	98.9	ubiquitin conju...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003613 258 338 PF04564 U box

IPR001841 481 525 PF00097 Zinc finger

HMMSmart IPR003613 262 331 SM00504 U box

ProfileScan IPR001841 481 526 PS50089 Zinc finger

ScanRegExp IPR001841 502 511 PS00518 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	258	338	PF04564	U box
IPR001841	481	525	PF00097	Zinc finger
HMMSmart	IPR003613	262	331	SM00504	U box
ProfileScan	IPR001841	481	526	PS50089	Zinc finger
ScanRegExp	IPR001841	502	511	PS00518	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	64 bp
Genome contig ID	gi66880554r_130005596
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTGGGGGAGACCTGAAGGTGGAGGAAGCAAGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGACCCCAGTGCCTCTGTTCTCTCTTGGGCTTGAATACCTCATGGTGTG

Gene/Protein Characteristic Table for mKIAA0860

Features of the cloned DNA sequence

Features of the protein sequence