| ROUGE |
Gene/Protein Characteristic Table for mKIAA0816 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129224 |
|---|---|
| Low-density lipoprotein receptor-related protein 4 precursor. | |
| mbg21892 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5802 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2981 bp Genome contig ID gi66880554f_91085583 PolyA signal sequence
(TATAAA,-22)
TATGATAATTTAATATAAATTTAGCTTTCTTAATTFlanking genome sequence
(133069 - 133118)
ATTTTGGCTGGCTTGGAGTCATGACTACTCTTGCACCTGCACTATCTGGA
KIAA Alignment based on: KIAA0816 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..2650, 2820..3677
Length: 1168 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
