ROUGE |
Gene/Protein Characteristic Table for mKIAA0774 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093263 |
---|---|
mbh01103 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4442 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1170 bp Genome contig ID gi65498774f_146867886 PolyA signal sequence
(AATAGA,-27) +----*----+----*----+----*----+----
CTACCCAAAATAGAGAAGAAAAGAAGGAAAGAAAGFlanking genome sequence
(337806 - 337855) ----+----*----+----*----+----*----+----*----+----*
AAAGAAAAAAAAAGAAAAGGTAGAAGCATGCCTATCTGCCACCGAGTGAT
KIAA Alignment based on: KIAA0774 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 3..3161, 3272..3871
Length: 1252 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |