Order Kazusa clone(s) from : ![]() |
Product ID | ORK00129 |
---|---|
Accession No | AB018317 |
Description | microtubule associated tumor suppressor candidate 2, transcript variant 1 |
Clone name | bh00283 |
Vector information | |
cDNA sequence | DNA sequence (4734 bp) Predicted protein sequence (1381 aa) |
Flexi ORF Clone | FXC00129 |
Source | Human adult brain |
Rouge ID |
mKIAA0774
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05183, former representative clones for KIAA0774 with bh00283. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 536 bp |
---|---|
Genome contig ID | gi51511729f_28396748 |
PolyA signal sequence (AATAGA,-12) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (579133 - 579182) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | f | 28496748 | 28975879 | 14 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ACCCAGATGACGCCACTACAC |
---|---|
Primer_r | GCAGTCTTACACGGGGATCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |