ROUGE

Gene/Protein Characteristic Table for mKIAA0737

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173012
Description :	Epidermal Langerhans cell protein LCP1.
Clone Name :	mej02120 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 3162 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1248 bp

Genome contig ID gi65540054f_47279703
PolyA signal sequence
(AGTAAA,-22)
+----*----+----*----+----*----+----
AGAGGTTTTACAAAGTAAAGAATCTGTGTTTGATG
Flanking genome sequence
(114914 - 114963)
----+----*----+----*----+----*----+----*----+----*
AAACATCTTTTAAATGTGCATTCATTTACATAATGCATAGGCCAATTTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0737 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0737	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 31..1914
Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE27616	3.8e-177	100.0	unnamed protein...	Mus musculus
Q8BU11	6.3e-177	99.8	TOX high mobili...	Mus musculus
BAE31864	1.3e-176	99.8	unnamed protein...	Mus musculus
BAC40170	2e-176	99.7	unnamed protein...	Mus musculus
AAH50091	2.2e-176	99.5	TOX high mobili...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000910 231 299 PF00505 HMG1/2 (high mobility group) box

HMMSmart IPR000910 230 300 SM00398 HMG1/2 (high mobility group) box

ProfileScan IPR000910 232 299 PS50118 HMG1/2 (high mobility group) box

NULL 409 498 PS50322 NULL

IPR000694 445 530 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000910	231	299	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	230	300	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	232	299	PS50118	HMG1/2 (high mobility group) box
NULL	409	498	PS50322	NULL
IPR000694	445	530	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1248 bp
Genome contig ID	gi65540054f_47279703
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- AGAGGTTTTACAAAGTAAAGAATCTGTGTTTGATG
Flanking genome sequence (114914 - 114963)	----+--------+--------+--------+--------+----* AAACATCTTTTAAATGTGCATTCATTTACATAATGCATAGGCCAATTTTT

Gene/Protein Characteristic Table for mKIAA0737

Features of the cloned DNA sequence

Features of the protein sequence