ROUGE |
Gene/Protein Characteristic Table for mKIAA0737 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173012 |
---|---|
Epidermal Langerhans cell protein LCP1. | |
mej02120 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3162 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1248 bp Genome contig ID gi65540054f_47279703 PolyA signal sequence
(AGTAAA,-22) +----*----+----*----+----*----+----
AGAGGTTTTACAAAGTAAAGAATCTGTGTTTGATGFlanking genome sequence
(114914 - 114963) ----+----*----+----*----+----*----+----*----+----*
AAACATCTTTTAAATGTGCATTCATTTACATAATGCATAGGCCAATTTTT
KIAA Alignment based on: KIAA0737 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 31..1914
Length: 627 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |