ROUGE

Gene/Protein Characteristic Table for mKIAA0731

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129202
Description :
Clone Name :	mpj02080 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1786 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 690 bp

Genome contig ID gi65527427f_57676496
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACCTTTCCATCCTTGGGAAAACAGAAAAACAAAAC
Flanking genome sequence
(108589 - 108638)
----+----*----+----*----+----*----+----*----+----*
AAAAAAACAAAAAAAAAACAAAAACGAAAATAAAAAAGAAAGAAAGAAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0731 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0731	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1096
Length: 364 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL07777	4.5e-138	100.0	mCG23048 [Mus m...	Mus musculus
Q6ZQ58	4.8e-138	100.0	La-related prot...	Mus musculus
XP_910122	5e-138	100.0	similar to La r...	Mus musculus
XP_126172	5.7e-138	100.0	la related prot...	Mus musculus
EDM04507	1.8e-136	98.9	La ribonucleopr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	690 bp
Genome contig ID	gi65527427f_57676496
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCTTTCCATCCTTGGGAAAACAGAAAAACAAAAC
Flanking genome sequence (108589 - 108638)	----+--------+--------+--------+--------+----* AAAAAAACAAAAAAAAAACAAAAACGAAAATAAAAAAGAAAGAAAGAAGA

Gene/Protein Characteristic Table for mKIAA0731

Features of the cloned DNA sequence

Features of the protein sequence