Order Kazusa clone(s) from : ![]() |
Product ID | ORK05806 |
---|---|
Accession No | AB018274 |
Description | La ribonucleoprotein domain family, member 1 |
Clone name | hk03714 |
Vector information | |
cDNA sequence | DNA sequence (4095 bp) Predicted protein sequence (1096 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0731
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006630 | 407 | 464 | PF05383 | RNA-binding protein Lupus La |
HMMSmart | IPR006630 | 401 | 477 | SM00715 | RNA-binding protein Lupus La |
IPR006607 | 884 | 925 | SM00684 | Protein of unknown function DM15 | |
IPR006607 | 926 | 964 | SM00684 | Protein of unknown function DM15 | |
IPR006607 | 965 | 1000 | SM00684 | Protein of unknown function DM15 | |
ProfileScan | IPR006630 | 397 | 487 | PS50961 | RNA-binding protein Lupus La |
ScanRegExp | IPR001199 | 652 | 659 | PS00191 | Cytochrome b5 |
![]() |
Primer_f | CCAACTATGCAGCCCACAAGA |
---|---|
Primer_r | GTGATGACAAACCCCAGATGA |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCAACTATGCAGCCCACAAGA |
Primer_r | GTGATGACAAACCCCAGATGA |
PCR product length | 129 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |