ROUGE |
Gene/Protein Characteristic Table for mKIAA0723 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129199 |
---|---|
matrin 3. | |
mbh02469 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3804 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 996 bp Genome contig ID gi65551972f_35685871 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
ACTGAAGTGAATACCAATAAAAAAAAAAAAAACTTFlanking genome sequence
(129223 - 129272) ----+----*----+----*----+----*----+----*----+----*
AGGTCATGTTGATTGGTTGGTTAAACATGTTTGGATGTTAACCAAAATAT
KIAA Alignment based on: KIAA0723 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 250..2808
Length: 852 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |