| ROUGE |
Gene/Protein Characteristic Table for mKIAA0710 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129196 |
|---|---|
| ubiquitin specific protease 52. | |
| mpm08013 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4911 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2735 bp Genome contig ID gi65524842f_127940174 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
TGTTTTATAAAATAAAAGTATTTTTATCTCATTAGFlanking genome sequence
(117997 - 118046) ----+----*----+----*----+----*----+----*----+----*
AAAACCGCTAGTGTGGGATTCTTTGGCTTCTTTCTTTCTTTGATTTGACT
KIAA Alignment based on: KIAA0710 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 218..1834, 2189..2653, 2891..4327
Length: 1172 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |