ROUGE |
Gene/Protein Characteristic Table for mKIAA0707 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122350 |
---|---|
Brown fat inducible thioesterase. | |
mbg07785 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5415 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3728 bp Genome contig ID gi65493515r_105603667 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAAATGCTTGAAACCGTGCCTGGGGTACACTAACCFlanking genome sequence
(99800 - 99751) ----+----*----+----*----+----*----+----*----+----*
ACTCAACAGCATGTTTCTGTCATTGTGAATTTTCACATGGGGAGAAAAAA
KIAA Alignment based on: KIAA0707 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1687
Length: 561 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |