ROUGE |
Gene/Protein Characteristic Table for mKIAA0671 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172997 |
---|---|
Cytokine inducible SH2-containing protein 5. | |
mid24027 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2936 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2339 bp Genome contig ID gi65550231f_84891453 PolyA signal sequence
(TATAAA,-23) +----*----+----*----+----*----+----
GTTTGTGTACAATATAAATATGCAACTTTGGGGTTFlanking genome sequence
(102937 - 102986) ----+----*----+----*----+----*----+----*----+----*
AATTTTTTTGTTAAAATATTAGTAGCTTACATTTAAAAAAAAAATTCCCC
KIAA Alignment based on: KIAA0671 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..597
Length: 198 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |