ROUGE

Gene/Protein Characteristic Table for mKIAA0671

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172997
Description :	Cytokine inducible SH2-containing protein 5.
Clone Name :	mid24027 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2936 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2339 bp

Genome contig ID gi65550231f_84891453
PolyA signal sequence
(TATAAA,-23)
+----*----+----*----+----*----+----
GTTTGTGTACAATATAAATATGCAACTTTGGGGTT
Flanking genome sequence
(102937 - 102986)
----+----*----+----*----+----*----+----*----+----*
AATTTTTTTGTTAAAATATTAGTAGCTTACATTTAAAAAAAAAATTCCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0671 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0671	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..597
Length: 198 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q29RN6	3.5e-94	100.0	Suppressor of c...	Bos taurus
XP_531810	3.5e-94	100.0	similar to Cyto...	Canis lupus fam...
O54928	3.5e-94	100.0	Suppressor of c...	Mus musculus
XP_001498770	3.5e-94	100.0	similar to Supp...	Equus caballus
AAH53015	3.5e-94	100.0	Suppressor of c...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000980 44 122 PD000093 SH2 motif

HMMPfam IPR000980 44 121 PF00017 SH2 motif

IPR001496 143 180 PF07525 SOCS protein

HMMSmart IPR000980 41 127 SM00252 SH2 motif

IPR001496 137 180 SM00253 SOCS protein

ProfileScan IPR000980 43 138 PS50001 SH2 motif

IPR001496 133 182 PS50225 SOCS protein

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	44	122	PD000093	SH2 motif
HMMPfam	IPR000980	44	121	PF00017	SH2 motif
IPR001496	143	180	PF07525	SOCS protein
HMMSmart	IPR000980	41	127	SM00252	SH2 motif
IPR001496	137	180	SM00253	SOCS protein
ProfileScan	IPR000980	43	138	PS50001	SH2 motif
IPR001496	133	182	PS50225	SOCS protein

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2339 bp
Genome contig ID	gi65550231f_84891453
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- GTTTGTGTACAATATAAATATGCAACTTTGGGGTT
Flanking genome sequence (102937 - 102986)	----+--------+--------+--------+--------+----* AATTTTTTTGTTAAAATATTAGTAGCTTACATTTAAAAAAAAAATTCCCC

Gene/Protein Characteristic Table for mKIAA0671

Features of the cloned DNA sequence

Features of the protein sequence