ROUGE |
Gene/Protein Characteristic Table for mKIAA0670 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122342 |
---|---|
Apoptotic chromatin condensation inducer in the nucleus. | |
mbh02512 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4370 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 567 bp Genome contig ID gi65540054r_49058873 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
TGGAAAAATAAAAATCTGACTTAGTTTTGACTAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTGAGTGCCTTTCCTTGGGAAGAGTTTGGGTGAAAGGGGAAGGTGAAT
KIAA Alignment based on: KIAA0670 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..3803
Length: 1266 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |