|
Order Kazusa clone(s) from : |
| Product ID | ORK04025 |
|---|---|
| Accession No | AB014570 |
| Description | apoptotic chromatin condensation inducer 1 |
| Clone name | hk02359s1 |
| Vector information | |
| cDNA sequence | DNA sequence (4444 bp) Predicted protein sequence (1286 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0670
by Kazusa Mouse cDNA Project
|
| Note | We replaced hk02359, former representative clones for KIAA0670 with hk02359s1. (2002/12/27) |
Length: 4444 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 581 bp |
|---|---|
| Genome contig ID | gi51511730r_22497689 |
| PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (99927 - 99878) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 14 | r | 22597616 | 22634172 | 19 | 99.7 | Perfect prediction |
Length: 1286 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
RT-PCR
|
|---|
Experimental conditions| Primer_f | TTCCTCCATCCTGCTTACCAC |
|---|---|
| Primer_r | GATATAAAGTGGAACCTGTGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 14
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TTCCTCCATCCTGCTTACCAC |
| Primer_r | GATATAAAGTGGAACCTGTGG |
| PCR product length | 183 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |