| ROUGE |
Gene/Protein Characteristic Table for mKIAA0829 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129225 |
|---|---|
| mpm05057 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4336 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 335 bp Genome contig ID gi65524842r_118678695 PolyA signal sequence
(ATTAAA,-19)
CCCTGTAATGTGTAGGATTAAAATGTTAAAACTTTFlanking genome sequence
(100000 - 99951)
ATGACCATGGATTTCTTGGTTTTGTAAATTCTCTCATTTAAAATCAATTC
KIAA Alignment based on: KIAA0829 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 3..4001
Length: 1332 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000357 | 145 | 181 | PF02985 | HEAT |
| IPR000357 | 272 | 308 | PF02985 | HEAT | |
| IPR000357 | 352 | 388 | PF02985 | HEAT | |
| IPR000357 | 954 | 989 | PF02985 | HEAT | |
| IPR000357 | 1103 | 1139 | PF02985 | HEAT | |
| ProfileScan | NULL | 416 | 446 | PS50312 | NULL |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
